Y-RNAs

ENA TPA Accession :
Print
Download


Entry NameAlias
Y RNAs YRNA, RNY RNAs, hY RNA (human), ENSG00000201098
Characteristics
83-112 nt. Four human Y RNAs (hY1, 112nt; hY3, 101nt; hY4, 93nt; and hY5, 83nt) encoded in single copy genes, which are present in a cluster in human chromosome 7 ((Maraia 1994)). Pyrimidine-rich, transcribed by RNA polymerase III, and contain a 5-triphosphate and a retained 3' poly(U) tail ((Hendrick 1981)).

Y RNAs form characteristic stem-loop structures, with a highly conserved double-stranded stem formed by partially complementary 5' and 3' terminal domains, linked by a loop domain containing secondary stem-loops ((Teunissen 1999), (O'Brien 1993), (van Gelder 1994)). Parts of the RNA structure appear to be flexible, able to adopt different conformations. Y RNAs contain an essential characteristic bulged C in the middle portion of the stem (in position 8 or 9), as well as the characteristic pyrimidine-rich region that is single-stranded in the secondary structures ((Teunissen 1999), (Green 1998)).
Expression
All four Y RNAs are primarily cytoplasmic, they are also detected in perinucleolar compartments, discrete structures near the nucleolar rim ((Matera 1995)).

Y RNAs are expressed in similar levels in all human tissues and cell lines investigated, with all Y RNAs showing a positively correlated expression across different tissue types ((Christov 2008))((Pruijn 1993)). Y RNAs are up-regulated in a number of human solid tumours compared to corresponding nonmalignant tissues. In particular, hY1 and hY3 RNAs are over-expressed in carcinomas and adenocarcinomas of the bladder, cervix, colon, kidney, lung and prostate ((Christov 2008)).
Function
The different Y RNAs may have multiple roles.

Y RNAs were identified as the RNA component of the 'small cytoplasmic' (sc) Ro autoantigen (soluble ribonucleoproteins (RNP) detected in sera of systemic lupus erythematosis patients), binding the autoantigen La and Ro proteins ((Lerner 1981)).

Y RNAs have been shown to be required for semiconservative chromosomal DNA replication in vitro, in a mammalian cell-free experimental system. hY1, hY3, hY4 and hY5 RNAs are functionally redundant ((Christov 2006)), and have been shown to act at the initiation step of DNA replication* ((Krude 2009)). (*See (Krude 2009) for review).

Regulate cell DNA replication and cell proliferation, with knock-down of hY1 and hY3 RNA in human cells causing a cytostatic arrest of cell proliferation ((Christov 2008), (Krude 2009), (Christov 2006)).

Bind to Ro proteins through their terminal stem, which contains conserved binding sites for Ro60 and La proteins ((Green 1998)). The central portion of the double-stranded stem is essential for reconstituting chromosomal DNA replication, while the central loop and the terminal stem are not ((Gardiner 2009)).

Different proteins may also bind Y RNAs or be present in human Ro RNPs, such as hnRNP K, PTB, RoBP1 and nucleolin ((Bouffard 2000), (Fabini 2000), (Fouraux 2002)), indicating that Y RNAs may be involved in their regulation, such as in the control of alternative splicing. hY5 RNA uniquely binds to ribosomal protein L5 and its binding partner 5S RNA, with Ro-Y5 suggested to have a specialized role in 5S ribosomal RNA quality control ((Hogg 2007)). Ro60 protein had been previously shown to bind misfolded small RNAs and suggested to be involved in quality control of the RNAs ((Shi 1996), (Stein 2005), (Fuchs 2006)). A role is also proposed in the regulation of the translation of ribosomal mRNA ((Pellizzoni 1998)).
Conservation
A single cluster of functional Y RNA genes is preserved throughout tetrapod evolution, which however exhibits clade-specific tandem duplications, gene-losses, and rearrangements ((Mosig 2007)).

Homologues of functional Y RNAs are present throughout vertebrates, with conserved synteny, but numbers vary between species, with individual gene-loss events having occurred during evolution in most classes (the mouse expresses only Y1 and Y3 RNAs, zebrafish only Y1, and chicken Y3 and Y4). No Y RNA gene has been identified in some species such as Drosophila melanogaster and Schistosoma species. ((Copeland 2009), (Pruijn 1993), (Mosig 2007), (Gardiner 2009), (O'Brien 1993), (Perreault 2007), (Farris 1995)). Y3 is the most conserved Ro RNA, not only by its more consistent presence in other species, but also at the levels of sequence divergence and secondary structure similarity ((Farris 1995)).

Recently, the 'sbRNAs' or stem-bulge RNAs from Caenorhabditis elegans have been identified as homologs of vertebrate Y RNAs present in nematode worms, showing the characteristic Ro protein binding motif ((Boria 2010)).

An Y-like RNA (as well as other small RNAs) has been also identified in the bacterium Deinococcus radiodurans binding to an ortholog of Ro60 (Rsr), which accumulate following UV irradiation, and contribute to the resistance to irradiation ((Chen 2000)).
Misc
Thousands of Y RNA 'retropseudogenes' are present among various species ((Perreault 2007)). It has been suggested that hY RNAs represent a novel class of nonautonomous, L1-dependent, retrotransposable elements ((Perreault 2005)).
Human Body Atlas
Sort values
Species
Species UCSC Genome Browser Link
Gallus Gallus (Chicken) NULL
Caenorhabditis elegans (Roundworm) NULL
Xenopus laevis (African clawed frog) NULL
Mus musculus (Mouse) mm9 chr6:47,738,069-47,738,179
Homo sapiens (Human) hg19 chr7:148,660,407-148,660,502
Danio rerio (Zebrafish) NULL
Literature
Pub Med ID Author Title Year
16943439 Christov Functional requirement of noncoding Y RNAs for human chromosomal DNA replication. 2006
18283318 Christov Noncoding human Y RNAs are overexpressed in tumours and required for cell proliferation. 2008
19474146 Gardiner A conserved motif of vertebrate Y RNAs essential for chromosomal DNA replication. 2009
19657016 Krude Y RNA functions at the initiation step of mammalian chromosomal DNA replication. 2009
19116308 Sim The subcellular distribution of an RNA quality control protein, the Ro autoantigen, is regulated by noncoding Y RNA binding. 2009
8863726 Farris Genes for murine Y1 and Y3 Ro RNAs have class 3 RNA polymerase III promoter structures and are unlinked on mouse chromosome 6. 1996
20349053 Boria Nematode sbRNAs: homologs of vertebrate Y RNAs. 2010
6164096 Lerner Two novel classes of small ribonucleoproteins detected by antibodies associated with lupus erythematosus. 1981
7520568 Maraia The human Y4 small cytoplasmic RNA gene is controlled by upstream elements and resides on chromosome 7 with all other hY scRNA genes. 1994
9671049 Green Binding of the 60-kDa Ro autoantigen to Y RNAs: evidence for recognition in the major groove of a conserved helix. 1998
7688474 O'Brien Xenopus Ro ribonucleoproteins: members of an evolutionarily conserved class of cytoplasmic ribonucleoproteins. 1993
8041611 van Gelder Common structural features of the Ro RNP associated hY1 and hY5 RNAs. 1994
7539809 Matera A perinucleolar compartment contains several RNA polymerase III transcripts as well as the polypyrimidine tract-binding protein, hnRNP I. 1995
17470436 Perreault Ro-associated Y RNAs in metazoans: evolution and diversification. 2007
18087752 Mosig Evolution of the vertebrate Y RNA cluster. 2007
7505620 Pruijn Ro RNP associated Y RNAs are highly conserved among mammals. 1993
7534247 Farris Y3 is the most conserved small RNA component of Ro ribonucleoprotein complexes in vertebrate species. 1995
10668799 Bouffard Interaction cloning and characterization of RoBPI, a novel protein binding to human Ro ribonucleoproteins. 2000
10785401 Fabini Analysis of the molecular composition of Ro ribonucleoprotein complexes. Identification of novel Y RNA-binding proteins. 2000
12096904 Fouraux Nucleolin associates with a subset of the human Ro ribonucleoprotein complexes. 2002
8752087 Shi A misfolded form of 5S rRNA is complexed with the Ro and La autoantigens. 1996
15907467 Stein Structural insights into RNA quality control: the Ro autoantigen binds misfolded RNAs via its central cavity. 2005
17041599 Fuchs Structural and biochemical basis for misfolded RNA recognition by the Ro autoantigen. 2006
9710533 Pellizzoni Involvement of the Xenopus laevis Ro60 autoantigen in the alternative interaction of La and CNBP proteins with the 5'UTR of L4 ribosomal protein mRNA. 1998
15817567 Perreault Retropseudogenes derived from the human Ro/SS-A autoantigen-associated hY RNAs. 2005
20012579 Krude Non-coding RNAs: new players in the field of eukaryotic DNA replication. 2009

showing of total 27 results

Associated Components
Component Type Component ID Description Pub Med ID
Protein Ro60 Y RNA-interacting protein. 6164096
Protein La Y RNA-interacting protein. 6164096
Sequences
Sequence Name Sequence Accessions Species Fasta Sequence
Y-RNAs_hg_1 NR_004391.1 Human GGCTGGTCCGAAGGTAGTGAGTTATCTCAATTGATTGTTCACAGTCAGTTACAGATCGAACTCCTTGTTCTACTCTTTCCCCCCTTCTCACTACTGCACTTGACTAGTCTTTT





lncrnadb version 2.0. lastupdate : 03 Sep 2015